Human ULBP3 PicoKine ELISA Kit

Human ULBP3 PicoKine ELISA Kit 

To Order Contact us: [email protected]

ULBP3 ELISA Kit (Human) (OKCA00738)

OKCA00738 96 Wells
EUR 833
Description: Description of target: Ligand for the KLRK1/NKG2D receptor, together with at least ULBP1 and ULBP2. ULBPs activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. Binding of ULBPs ligands to KLRK1/NKG2D induces calcium mobilization and activation of the JAK2, STAT5, ERK and PI3K kinase/Akt signal transduction pathway. Has lower affinity for KLRK1/NKG2D compared to ULBP1 and ULBP2 and induces weaker signaling responses than does ULBP2 or ULBP1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156mU/mL

ULBP3 siRNA

20-abx939004
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human NKG2D ligand 3, ULBP3 ELISA KIT

ELI-16826h 96 Tests
EUR 824

Human NKG2D ligand 3(ULBP3) ELISA kit

CSB-EL025611HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human NKG2D ligand 3 (ULBP3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human NKG2D ligand 3(ULBP3) ELISA kit

1-CSB-EL025611HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human NKG2D ligand 3(ULBP3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human ULBP3 shRNA Plasmid

20-abx962389
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ULBP3 Recombinant Protein (Human)

RP044656 100 ug Ask for price

ULBP3 cloning plasmid

CSB-CL883648HU-10ug 10ug
EUR 315
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: ATGGCAGCGGCCGCCAGCCCCGCGATCCTTCCGCGCCTCGCGATTCTTCCGTACCTGCTATTCGACTGGTCCGGGACGGGGCGGGCCGACGCTCACTCTCTCTGGTATAACTTCACCATCATTCATTTGCCCAGACATGGGCAACAGTGGTGTGAGGTCCAGAGCCAGGTGGATCA
  • Show more
Description: A cloning plasmid for the ULBP3 gene.

ULBP3 ORF Vector (Human) (pORF)

ORF014886 1.0 ug DNA
EUR 354

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human ADAMTS4 PicoKine ELISA Kit

EK1372 96 wells
EUR 425
Description: For quantitative detection of human ADAMTS4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ANGPTL3 PicoKine ELISA Kit

EK1374 96 wells
EUR 425
Description: For quantitative detection of human ANGPTL3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human TGFBR3 PicoKine ELISA Kit

EK1383 96 wells
EUR 425
Description: For quantitative detection of human TGFBR3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human LOXL2 PicoKine ELISA Kit

EK1391 96 wells
EUR 425
Description: For quantitative detection of human LOXL2 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

Human Epiregulin PicoKine ELISA Kit

EK1394 96 wells
EUR 425
Description: For quantitative detection of human Epiregulin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD97 PicoKine ELISA Kit

EK1402 96 wells
EUR 425
Description: For quantitative detection of human CD97 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human COMT PicoKine ELISA Kit

EK1406 96 wells
EUR 425
Description: For quantitative detection of human COMT in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human NRCAM PicoKine ELISA Kit

EK1408 96 wells
EUR 425
Description: For quantitative detection of human NRCAM in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD5L PicoKine ELISA Kit

EK1413 96 wells
EUR 425
Description: For quantitative detection of activated human CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD44 PicoKine ELISA Kit

EK1418 96 wells
EUR 425
Description: For quantitative detection of human CD44 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD47 PicoKine ELISA Kit

EK1421 96 wells
EUR 425
Description: For quantitative detection of human CD47 in cell culture supernates and serum.

Human CD28 PicoKine ELISA Kit

EK1429 96 wells
EUR 425
Description: For quantitative detection of human CD28 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Hepcidin PicoKine ELISA Kit

EK1431 96 wells
EUR 425
Description: For quantitative detection of human Hepcidin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ADA PicoKine ELISA Kit

EK1446 96 wells
EUR 425
Description: For quantitative detection of human ADA in cell culture supernates, serum and pleural fluid.

Human IDS PicoKine ELISA Kit

EK1452 96 wells
EUR 425
Description: For quantitative detection of human IDS in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human APOE PicoKine ELISA Kit

EK1455 96 wells
EUR 425
Description: For quantitative detection of human APOE in cell culture supernates, serum, plasma(heparin, EDTA), saliva, milk and urine.

Human APOA1 PicoKine ELISA Kit

EK1456 96 wells
EUR 425
Description: For quantitative detection of human APOA1 in cell culture supernates, serum, plasma(heparin, EDTA) and urine.

Human FABP4 PicoKine ELISA Kit

EK1459 96 wells
EUR 425
Description: For quantitative detection of human FABP4 in cell culture supernates, serum, plasma(heparin, EDTA) and cell lysates.

Human Hemopexin PicoKine ELISA Kit

EK1466 96 wells
EUR 425
Description: For quantitative detection of human Hemopexin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human GHR PicoKine ELISA Kit

EK1467 96 wells
EUR 425
Description: For quantitative detection of human GHR in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human HE4 PicoKine ELISA Kit

EK1469 96 wells
EUR 425
Description: For quantitative detection of human HE4 in cell culture supernates, serum, plasma(heparin, EDTA), saliva, urine and human milk.

Human SFRP5 PicoKine ELISA Kit

EK1472 96 wells
EUR 425
Description: For quantitative detection of human SFRP5 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ADAM15 PicoKine ELISA Kit

EK1484 96 wells
EUR 425
Description: For quantitative detection of human ADAM15 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Afamin PicoKine ELISA Kit

EK1487 96 wells
EUR 425
Description: For quantitative detection of human Afamin in cell culture supernates, serum and urine.

Human EDIL3 PicoKine ELISA Kit

EK1500 96 wells
EUR 425
Description: For quantitative detection of human EDIL3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human SPHK1 PicoKine ELISA Kit

EK1501 96 wells
EUR 425
Description: For quantitative detection of human SPHK1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human LRIG3 PicoKine ELISA Kit

EK1503 96 wells
EUR 425
Description: For quantitative detection of human LRIG3 in cell culture supernates, serum and plasma(heparin).

Human BCHE PicoKine ELISA Kit

EK1507 96 wells
EUR 425
Description: For quantitative detection of human BCHE in cell culture supernates, serum, plasma (heparin, EDTA), saliva, urine and human milk.

Human Persephin PicoKine ELISA Kit

EK1509 96 wells
EUR 425
Description: For quantitative detection of human Persephin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human TREML1 PicoKine ELISA Kit

EK1521 96 wells
EUR 425
Description: For quantitative detection of human TREML1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human WIF1 PicoKine ELISA Kit

EK1524 96 wells
EUR 425
Description: For quantitative detection of human WIF1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD48 PicoKine ELISA Kit

EK1527 96 wells
EUR 425
Description: For quantitative detection of human CD48 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ICAM5 PicoKine ELISA Kit

EK1529 96 wells
EUR 425
Description: For quantitative detection of human ICAM5 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human GREM2 PicoKine ELISA Kit

EK1533 96 wells
EUR 425
Description: For quantitative detection of human GREM2 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Artemin PicoKine ELISA Kit

EK1534 96 wells
EUR 425
Description: For Quantitative Detection of human Artemin in cell culture supernates, serum and plasma (heparin, EDTA).

Human FOLR2 PicoKine ELISA Kit

EK1539 96 wells
EUR 425
Description: For quantitative detection of human FOLR2 in cell culture supernates and serum.

Human LDLR PicoKine ELISA Kit

EK1542 96 wells
EUR 425
Description: For quantitative detection of human LDLR in cell culture supernates, serum, plasma(heparin) and urine.

Human Oncomodulin PicoKine ELISA Kit

EK1545 96 wells
EUR 425
Description: For quantitative detection of human Oncomodulin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human BCAM PicoKine ELISA Kit

EK1546 96 wells
EUR 425
Description: For quantitative detection of human BCAM in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human S100A8 PicoKine ELISA Kit

EK1558 96 wells
EUR 425
Description: For quantitative detection of human S100A8 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human S100A13 PicoKine ELISA Kit

EK1568 96 wells
EUR 425
Description: For quantitative detection of human S100A13 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Siglec5 PicoKine ELISA Kit

EK1583 96 wells
EUR 425
Description: For quantitative detection of human Siglec5 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human HGFA PicoKine ELISA Kit

EK1592 96 wells
EUR 425
Description: For quantitative detection of human HGFA in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ULBP2 PicoKine ELISA Kit

EK1593 96 wells
EUR 425
Description: For quantitative detection of human ULBP2 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Bikunin PicoKine ELISA Kit

EK1598 96 wells
EUR 425
Description: For Quantitative Detection of human Bikunin in cell culture supernates, serum and plasma (heparin, EDTA).

Human Dystroglycan PicoKine ELISA Kit

EK1614 96 wells
EUR 425
Description: For Quantitative Detection of human Dystroglycan in cell culture supernates, serum, plasma (heparin, EDTA), saliva and urine.

Human NOTCH1 PicoKine ELISA Kit

EK1619 96 wells
EUR 455
Description: For Quantitative Detection of human NOTCH1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human GSTA PicoKine ELISA Kit

EK1625 96 wells
EUR 425
Description: For quantitative detection of human GSTA in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD209 PicoKine ELISA Kit

EK1632 96 wells
EUR 425
Description: For Quantitative Detection of human CD209 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Properdin PicoKine ELISA Kit

EK1653 96 wells
EUR 425
Description: For Quantitative Detection of human Properdin in cell culture supernates, serum and plasma (heparin, EDTA).

Human Autotaxin PicoKine ELISA Kit

EK1655 96 wells
EUR 425
Description: For Quantitative Detection of human Autotaxin in cell culture supernates, serum, plasma (heparin), urine and human milk.

Human CDNF PicoKine ELISA Kit

EK1656 96 wells
EUR 455
Description: For Quantitative Detection of human CDNF in cell culture supernates, serum and plasma (heparin, EDTA).

Human IL15RA PicoKine ELISA Kit

EK1663 96 wells
EUR 425
Description: For Quantitative Detection of human IL15RA in cell culture supernates, serum and plasma (heparin, EDTA).

Human SMOC2 PicoKine ELISA Kit

EK1664 96 wells
EUR 425
Description: For Quantitative Detection of human SMOC2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CDCP1 PicoKine ELISA Kit

EK1668 96 wells
EUR 455
Description: For Quantitative Detection of human CDCP1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human ITIH4 PicoKine ELISA Kit

EK1670 96 wells
EUR 455
Description: For quantitative detection of human ITIH4 in cell culture supernates, serum and plasma (heparin, EDTA).

Human TRKC PicoKine ELISA Kit

EK1676 96 wells
EUR 425
Description: For quantitative detection of human TRKC in cell culture supernates, serum and plasma (heparin, EDTA).

Human TREM2 PicoKine ELISA Kit

EK1678 96 wells
EUR 425
Description: For quantitative detection of human TREM2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human ULBP1 PicoKine ELISA Kit

EK1685 96 wells
EUR 425
Description: For quantitative detection of human ULBP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Klotho PicoKine ELISA Kit

EK1688 96 wells
EUR 425
Description: For quantitative detection of human Klotho in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human B2M PicoKine ELISA Kit

EK1691 96 wells
EUR 425
Description: For quantitative detection of human B2M in cell culture supernates, serum, plasma (heparin, EDTA), saliva, urine and human milk.

Human Haptoglobin PicoKine ELISA Kit

EK1702 96 wells
EUR 455
Description: For quantitative detection of human Haptoglobin in cell culture supernates, serum and plasma (heparin, EDTA).

Human FGFBP1 PicoKine ELISA Kit

EK1706 96 wells
EUR 425
Description: For quantitative detection of human FGFBP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human PROS1 PicoKine ELISA Kit

EK1739 96 wells
EUR 425
Description: For quantitative detection of human PROS1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human ckmm PicoKine ELISA Kit

EK1751 96 wells
EUR 425
Description: For quantitative detection of human ckmm in cell culture supernates, serum and plasma (heparin, EDTA).

Human ROBO1 PicoKine ELISA Kit

EK1755 96 wells
EUR 425
Description: For quantitative detection of human ROBO1 in cell culture supernates, serum and plasma (heparin).

Human Ki67 PicoKine ELISA Kit

EK1759 96 wells
EUR 455
Description: For quantitative detection of human Ki67 in cell culture supernates, serum and plasma (heparin, EDTA).

Human PAM PicoKine ELISA Kit

EK1765 96 wells
EUR 425
Description: For quantitative detection of human PAM in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human TINAGL1 PicoKine ELISA Kit

EK1766 96 wells
EUR 425
Description: For quantitative detection of human TINAGL1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human CPA1 PicoKine ELISA Kit

EK1770 96 wells
EUR 425
Description: For quantitative detection of human CPA1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human EphA1 PicoKine ELISA Kit

EK1796 96 wells
EUR 425
Description: For quantitative detection of human EphA1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human EphA2 PicoKine ELISA Kit

EK1797 96 wells
EUR 425
Description: For quantitative detection of human EphA2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CD164 PicoKine ELISA Kit

EK1811 96 wells
EUR 425
Description: For quantitative detection of human CD164 in cell culture supernates, serum and plasma (heparin, EDTA).

Human REG1A PicoKine ELISA Kit

EK1812 96 wells
EUR 425
Description: For quantitative detection of human REG1A in cell culture supernates, serum and plasma (heparin).

Human CES1 PicoKine ELISA Kit

EK1813 96 wells
EUR 425
Description: For quantitative detection of human CES1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CES2 PicoKine ELISA Kit

EK1814 96 wells
EUR 425
Description: For quantitative detection of human CES2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human REG3A PicoKine ELISA Kit

EK1834 96 wells
EUR 425
Description: For quantitative detection of human REG3A in cell culture supernates, serum and plasma (heparin).

Human LYPD3 PicoKine ELISA Kit

EK1837 96 wells
EUR 425
Description: For quantitative detection of human LYPD3 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human MANF PicoKine ELISA Kit

EK1845 96 wells
EUR 425
Description: For quantitative detection of human MANF in cell culture supernates, serum and plasma (heparin, EDTA).

Human CD200R1 PicoKine ELISA Kit

EK1850 96 wells
EUR 425
Description: For quantitative detection of human CD200R1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human EDAR PicoKine ELISA Kit

EK1851 96 wells
EUR 425
Description: For quantitative detection of human EDAR in cell culture supernates, serum and plasma (heparin, EDTA).

Human Brorin PicoKine ELISA Kit

EK1852 96 wells
EUR 425
Description: For quantitative detection of human Brorin in cell culture supernates, serum and plasma (heparin, EDTA).

Human ULBP3 PicoKine ELISA Kit