Human DAND5/COCO PicoKine ELISA Kit

Human DAND5/COCO PicoKine ELISA Kit 

To Order Contact us: [email protected]

COCO/DAND5 Blocking Peptide

3626BP-50
EUR 153

DAND5 ELISA KIT|Human

EF009002 96 Tests
EUR 689

DAND5 ELISA Kit (Human) (OKBB01161)

OKBB01161 96 Wells
EUR 544
Description: Description of target: This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to bind Nodal and to inhibit the Nodal signaling pathway which patterns left/right body asymmetry.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

DAND5 antibody

10R-3803 100 ul
EUR 726
Description: Mouse monoclonal DAND5 antibody

DAND5 Antibody

43367-100ul 100ul
EUR 252

DAND5 Antibody

1-CSB-PA850835LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAND5. Recognizes DAND5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DAND5 siRNA

20-abx913553
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAND5 siRNA

20-abx913554
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DAND5

YF-PA26960 50 ul
EUR 334
Description: Mouse polyclonal to DAND5

Human DAND5 shRNA Plasmid

20-abx966210
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

DAND5 Conjugated Antibody

C43367 100ul
EUR 397

DAND5 cloning plasmid

CSB-CL850835HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 570
  • Sequence: ATGCTCCTTGGCCAGCTATCCACTCTTCTGTGCCTGCTTAGCGGGGCCCTGCCTACAGGCTCAGGGAGGCCTGAACCCCAGTCTCCTCGACCTCAGTCCTGGGCTGCAGCCAATCAGACCTGGGCTCTGGGCCCAGGGGCCCTGCCCCCACTGGTGCCAGCTTCTGCCCTTGGGAG
  • Show more
Description: A cloning plasmid for the DAND5 gene.

DAND5 Polyclonal Antibody

A56955 100 µg
EUR 570.55
Description: The best epigenetics products

anti- DAND5 antibody

FNab02234 100µg
EUR 585
  • Immunogen: DAN domain family, member 5
  • Uniprot ID: Q8N907
  • Gene ID: 199699
  • Research Area: Developmental biology
Description: Antibody raised against DAND5

Anti-DAND5 antibody

PAab02234 100 ug
EUR 412

Human ULBP1 PicoKine ELISA Kit

EK1685 96 wells
EUR 425
Description: For quantitative detection of human ULBP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human ULBP3 PicoKine ELISA Kit

EK1686 96 wells
EUR 425
Description: For quantitative detection of human ULBP3 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Klotho PicoKine ELISA Kit

EK1688 96 wells
EUR 425
Description: For quantitative detection of human Klotho in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human B2M PicoKine ELISA Kit

EK1691 96 wells
EUR 425
Description: For quantitative detection of human B2M in cell culture supernates, serum, plasma (heparin, EDTA), saliva, urine and human milk.

Human Haptoglobin PicoKine ELISA Kit

EK1702 96 wells
EUR 455
Description: For quantitative detection of human Haptoglobin in cell culture supernates, serum and plasma (heparin, EDTA).

Human FGFBP1 PicoKine ELISA Kit

EK1706 96 wells
EUR 425
Description: For quantitative detection of human FGFBP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human PROS1 PicoKine ELISA Kit

EK1739 96 wells
EUR 425
Description: For quantitative detection of human PROS1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human ckmm PicoKine ELISA Kit

EK1751 96 wells
EUR 425
Description: For quantitative detection of human ckmm in cell culture supernates, serum and plasma (heparin, EDTA).

Human ROBO1 PicoKine ELISA Kit

EK1755 96 wells
EUR 425
Description: For quantitative detection of human ROBO1 in cell culture supernates, serum and plasma (heparin).

Human Ki67 PicoKine ELISA Kit

EK1759 96 wells
EUR 455
Description: For quantitative detection of human Ki67 in cell culture supernates, serum and plasma (heparin, EDTA).

Human PAM PicoKine ELISA Kit

EK1765 96 wells
EUR 425
Description: For quantitative detection of human PAM in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human TINAGL1 PicoKine ELISA Kit

EK1766 96 wells
EUR 425
Description: For quantitative detection of human TINAGL1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human CPA1 PicoKine ELISA Kit

EK1770 96 wells
EUR 425
Description: For quantitative detection of human CPA1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human EphA1 PicoKine ELISA Kit

EK1796 96 wells
EUR 425
Description: For quantitative detection of human EphA1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human EphA2 PicoKine ELISA Kit

EK1797 96 wells
EUR 425
Description: For quantitative detection of human EphA2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CD164 PicoKine ELISA Kit

EK1811 96 wells
EUR 425
Description: For quantitative detection of human CD164 in cell culture supernates, serum and plasma (heparin, EDTA).

Human REG1A PicoKine ELISA Kit

EK1812 96 wells
EUR 425
Description: For quantitative detection of human REG1A in cell culture supernates, serum and plasma (heparin).

Human CES1 PicoKine ELISA Kit

EK1813 96 wells
EUR 425
Description: For quantitative detection of human CES1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CES2 PicoKine ELISA Kit

EK1814 96 wells
EUR 425
Description: For quantitative detection of human CES2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human REG3A PicoKine ELISA Kit

EK1834 96 wells
EUR 425
Description: For quantitative detection of human REG3A in cell culture supernates, serum and plasma (heparin).

Human LYPD3 PicoKine ELISA Kit

EK1837 96 wells
EUR 425
Description: For quantitative detection of human LYPD3 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human MANF PicoKine ELISA Kit

EK1845 96 wells
EUR 425
Description: For quantitative detection of human MANF in cell culture supernates, serum and plasma (heparin, EDTA).

Human CD200R1 PicoKine ELISA Kit

EK1850 96 wells
EUR 425
Description: For quantitative detection of human CD200R1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human EDAR PicoKine ELISA Kit

EK1851 96 wells
EUR 425
Description: For quantitative detection of human EDAR in cell culture supernates, serum and plasma (heparin, EDTA).

Human Brorin PicoKine ELISA Kit

EK1852 96 wells
EUR 425
Description: For quantitative detection of human Brorin in cell culture supernates, serum and plasma (heparin, EDTA).

Human EDA PicoKine ELISA Kit

EK1856 96 wells
EUR 425
Description: For quantitative detection of human EDA in cell culture supernates, serum and plasma (heparin, EDTA).

Human TSKU PicoKine ELISA Kit

EK1859 96 wells
EUR 425
Description: For quantitative detection of human TSKU in cell culture supernates, serum and plasma (heparin, EDTA).

Human CPA2 PicoKine ELISA Kit

EK1861 96 wells
EUR 425
Description: For quantitative detection of human CPA2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human SEZ6L PicoKine ELISA Kit

EK1862 96 wells
EUR 425
Description: For quantitative detection of human SEZ6L in cell culture supernates, serum and plasma (heparin).

Human SLITRK1 PicoKine ELISA Kit

EK1866 96 wells
EUR 425
Description: For quantitative detection of human SLITRK1 in cell culture supernates, serum and plasma (heparin).

Human SLITRK2 PicoKine ELISA Kit

EK1867 96 wells
EUR 425
Description: For quantitative detection of human SLITRK2 in cell culture supernates, serum and plasma (heparin).

Human SLITRK6 PicoKine ELISA Kit

EK1868 96 wells
EUR 425
Description: For quantitative detection of human SLITRK6 in cell culture supernates, serum and plasma (heparin).

Human AKR1C3 PicoKine ELISA Kit

EK1869 96 wells
EUR 425
Description: For quantitative detection of human AKR1C3 in cell culture supernates, serum and plasma (heparin, EDTA).

Human AKR1C4 PicoKine ELISA Kit

EK1870 96 wells
EUR 425
Description: For quantitative detection of human AKR1C4 in cell culture supernates, serum and plasma (heparin, EDTA).

Human PAPPA2 PicoKine ELISA Kit

EK1871 96 wells
EUR 425
Description: For quantitative detection of human PAPPA2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human PZP PicoKine ELISA Kit

EK1873 96 wells
EUR 425
Description: For quantitative detection of human PZP in cell culture supernates, serum and plasma (heparin, EDTA).

Human RET PicoKine ELISA Kit

EK1877 96 wells
EUR 425
Description: For quantitative detection of human RET in cell culture supernates, serum and plasma (heparin).

Human B4GALT1 PicoKine ELISA Kit

EK1880 96 wells
EUR 425
Description: For quantitative detection of human B4GALT1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CTRP9 PicoKine ELISA Kit

EK1881 96 wells
EUR 425
Description: For quantitative detection of human CTRP9 in cell culture supernates, serum and plasma (heparin).

Human CPE PicoKine ELISA Kit

EK1887 96 wells
EUR 425
Description: For quantitative detection of human CPE in For quantitative detection of human CPE in cell culture supernates, serum and plasma (heparin, EDTA).

Human P4HB PicoKine ELISA Kit

EK1890 96 wells
EUR 425
Description: For quantitative detection of human P4HB in cell culture supernates, serum and plasma (heparin, EDTA).

Human HTRA2 PicoKine ELISA Kit

EK1893 96 wells
EUR 425
Description: For quantitative detection of human HTRA2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CLEC1B PicoKine ELISA Kit

EK1921 96 wells
EUR 425
Description: For quantitative detection of human CLEC1B in cell culture supernates, serum and plasma (heparin, EDTA).

Human FCRL1 PicoKine ELISA Kit

EK1930 96 wells
EUR 425
Description: For quantitative detection of human FCRL1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human LY9 PicoKine ELISA Kit

EK1932 96 wells
EUR 425
Description: For quantitative detection of human LY9 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CFHR5 PicoKine ELISA Kit

EK1933 96 wells
EUR 425
Description: For quantitative detection of human CFHR5 in cell culture supernates, serum and plasma (heparin, EDTA) and urine.

Human C1S PicoKine ELISA Kit

EK1934 96 wells
EUR 425
Description: For quantitative detection of human C1S in cell culture supernates, serum and plasma (heparin, EDTA, citrate) and urine.

Human FCRL5 PicoKine ELISA Kit

EK1935 96 wells
EUR 425
Description: For quantitative detection of human FCRL5 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CA3 PicoKine ELISA Kit

EK1938 96 wells
EUR 425
Description: For quantitative detection of human CA3 in cell culture supernates, serum and plasma (heparin, EDTA, citrate) and urine.

Human CA4 PicoKine ELISA Kit

EK1939 96 wells
EUR 425
Description: For quantitative detection of human CA4 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human CA6 PicoKine ELISA Kit

EK1941 96 wells
EUR 425
Description: For quantitative detection of human CA6 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CA12 PicoKine ELISA Kit

EK1942 96 wells
EUR 425
Description: For quantitative detection of human CA12 in cell culture supernates, serum.

Human CLEC11A PicoKine ELISA Kit

EK1943 96 wells
EUR 425
Description: For quantitative detection of human CLEC11A in cell culture supernates, serum and plasma (heparin, EDTA).

Human PLA2G2A PicoKine ELISA Kit

EK1944 96 wells
EUR 425
Description: For quantitative detection of human PLA2G2A in cell culture supernates, serum and plasma (heparin, EDTA).

Human Neudesin PicoKine ELISA Kit

EK1946 96 wells
EUR 425
Description: For quantitative detection of human Neudesin in cell culture supernates, serum and plasma (heparin, EDTA).

Human CD55 PicoKine ELISA Kit

EK1948 96 wells
EUR 425
Description: For quantitative detection of human CD55 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Renalase PicoKine ELISA Kit

EK1951 96 wells
EUR 425
Description: For quantitative detection of human Renalase in cell culture supernates, serum and plasma (heparin).

Human GIF PicoKine ELISA Kit

EK1952 96 wells
EUR 425
Description: For quantitative detection of human GIF in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human DAND5/COCO PicoKine ELISA Kit