Human DAND5/COCO PicoKine ELISA Kit

Human DAND5/COCO PicoKine ELISA Kit 

To Order Contact us: [email protected]

COCO/DAND5 Blocking Peptide

3626BP-50
EUR 153

DAND5 ELISA KIT|Human

EF009002 96 Tests
EUR 689

DAND5 ELISA Kit (Human) (OKBB01161)

OKBB01161 96 Wells
EUR 544
Description: Description of target: This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to bind Nodal and to inhibit the Nodal signaling pathway which patterns left/right body asymmetry.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

DAND5 siRNA

20-abx913553
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAND5 siRNA

20-abx913554
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAND5 Antibody

43367-100ul 100ul
EUR 252

DAND5 antibody

10R-3803 100 ul
EUR 726
Description: Mouse monoclonal DAND5 antibody

DAND5 Antibody

1-CSB-PA850835LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAND5. Recognizes DAND5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-DAND5

YF-PA26960 50 ul
EUR 334
Description: Mouse polyclonal to DAND5

Human DAND5 shRNA Plasmid

20-abx966210
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

DAND5 Conjugated Antibody

C43367 100ul
EUR 397

anti- DAND5 antibody

FNab02234 100µg
EUR 585
  • Immunogen: DAN domain family, member 5
  • Uniprot ID: Q8N907
  • Gene ID: 199699
  • Research Area: Developmental biology
Description: Antibody raised against DAND5

DAND5 Polyclonal Antibody

A56955 100 µg
EUR 570.55
Description: The best epigenetics products

DAND5 cloning plasmid

CSB-CL850835HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 570
  • Sequence: ATGCTCCTTGGCCAGCTATCCACTCTTCTGTGCCTGCTTAGCGGGGCCCTGCCTACAGGCTCAGGGAGGCCTGAACCCCAGTCTCCTCGACCTCAGTCCTGGGCTGCAGCCAATCAGACCTGGGCTCTGGGCCCAGGGGCCCTGCCCCCACTGGTGCCAGCTTCTGCCCTTGGGAG
  • Show more
Description: A cloning plasmid for the DAND5 gene.

Anti-DAND5 antibody

PAab02234 100 ug
EUR 412

Human ADAMTS4 PicoKine ELISA Kit

EK1372 96 wells
EUR 425
Description: For quantitative detection of human ADAMTS4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ANGPTL3 PicoKine ELISA Kit

EK1374 96 wells
EUR 425
Description: For quantitative detection of human ANGPTL3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human TGFBR3 PicoKine ELISA Kit

EK1383 96 wells
EUR 425
Description: For quantitative detection of human TGFBR3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human LOXL2 PicoKine ELISA Kit

EK1391 96 wells
EUR 425
Description: For quantitative detection of human LOXL2 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

Human Epiregulin PicoKine ELISA Kit

EK1394 96 wells
EUR 425
Description: For quantitative detection of human Epiregulin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD97 PicoKine ELISA Kit

EK1402 96 wells
EUR 425
Description: For quantitative detection of human CD97 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human COMT PicoKine ELISA Kit

EK1406 96 wells
EUR 425
Description: For quantitative detection of human COMT in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human NRCAM PicoKine ELISA Kit

EK1408 96 wells
EUR 425
Description: For quantitative detection of human NRCAM in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD5L PicoKine ELISA Kit

EK1413 96 wells
EUR 425
Description: For quantitative detection of activated human CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD44 PicoKine ELISA Kit

EK1418 96 wells
EUR 425
Description: For quantitative detection of human CD44 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD47 PicoKine ELISA Kit

EK1421 96 wells
EUR 425
Description: For quantitative detection of human CD47 in cell culture supernates and serum.

Human CD28 PicoKine ELISA Kit

EK1429 96 wells
EUR 425
Description: For quantitative detection of human CD28 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Hepcidin PicoKine ELISA Kit

EK1431 96 wells
EUR 425
Description: For quantitative detection of human Hepcidin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ADA PicoKine ELISA Kit

EK1446 96 wells
EUR 425
Description: For quantitative detection of human ADA in cell culture supernates, serum and pleural fluid.

Human IDS PicoKine ELISA Kit

EK1452 96 wells
EUR 425
Description: For quantitative detection of human IDS in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human APOE PicoKine ELISA Kit

EK1455 96 wells
EUR 425
Description: For quantitative detection of human APOE in cell culture supernates, serum, plasma(heparin, EDTA), saliva, milk and urine.

Human APOA1 PicoKine ELISA Kit

EK1456 96 wells
EUR 425
Description: For quantitative detection of human APOA1 in cell culture supernates, serum, plasma(heparin, EDTA) and urine.

Human FABP4 PicoKine ELISA Kit

EK1459 96 wells
EUR 425
Description: For quantitative detection of human FABP4 in cell culture supernates, serum, plasma(heparin, EDTA) and cell lysates.

Human Hemopexin PicoKine ELISA Kit

EK1466 96 wells
EUR 425
Description: For quantitative detection of human Hemopexin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human GHR PicoKine ELISA Kit

EK1467 96 wells
EUR 425
Description: For quantitative detection of human GHR in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human HE4 PicoKine ELISA Kit

EK1469 96 wells
EUR 425
Description: For quantitative detection of human HE4 in cell culture supernates, serum, plasma(heparin, EDTA), saliva, urine and human milk.

Human SFRP5 PicoKine ELISA Kit

EK1472 96 wells
EUR 425
Description: For quantitative detection of human SFRP5 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ADAM15 PicoKine ELISA Kit

EK1484 96 wells
EUR 425
Description: For quantitative detection of human ADAM15 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Afamin PicoKine ELISA Kit

EK1487 96 wells
EUR 425
Description: For quantitative detection of human Afamin in cell culture supernates, serum and urine.

Human EDIL3 PicoKine ELISA Kit

EK1500 96 wells
EUR 425
Description: For quantitative detection of human EDIL3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human SPHK1 PicoKine ELISA Kit

EK1501 96 wells
EUR 425
Description: For quantitative detection of human SPHK1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human LRIG3 PicoKine ELISA Kit

EK1503 96 wells
EUR 425
Description: For quantitative detection of human LRIG3 in cell culture supernates, serum and plasma(heparin).

Human BCHE PicoKine ELISA Kit

EK1507 96 wells
EUR 425
Description: For quantitative detection of human BCHE in cell culture supernates, serum, plasma (heparin, EDTA), saliva, urine and human milk.

Human Persephin PicoKine ELISA Kit

EK1509 96 wells
EUR 425
Description: For quantitative detection of human Persephin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human TREML1 PicoKine ELISA Kit

EK1521 96 wells
EUR 425
Description: For quantitative detection of human TREML1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human WIF1 PicoKine ELISA Kit

EK1524 96 wells
EUR 425
Description: For quantitative detection of human WIF1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD48 PicoKine ELISA Kit

EK1527 96 wells
EUR 425
Description: For quantitative detection of human CD48 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ICAM5 PicoKine ELISA Kit

EK1529 96 wells
EUR 425
Description: For quantitative detection of human ICAM5 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human GREM2 PicoKine ELISA Kit

EK1533 96 wells
EUR 425
Description: For quantitative detection of human GREM2 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Artemin PicoKine ELISA Kit

EK1534 96 wells
EUR 425
Description: For Quantitative Detection of human Artemin in cell culture supernates, serum and plasma (heparin, EDTA).

Human FOLR2 PicoKine ELISA Kit

EK1539 96 wells
EUR 425
Description: For quantitative detection of human FOLR2 in cell culture supernates and serum.

Human LDLR PicoKine ELISA Kit

EK1542 96 wells
EUR 425
Description: For quantitative detection of human LDLR in cell culture supernates, serum, plasma(heparin) and urine.

Human Oncomodulin PicoKine ELISA Kit

EK1545 96 wells
EUR 425
Description: For quantitative detection of human Oncomodulin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human BCAM PicoKine ELISA Kit

EK1546 96 wells
EUR 425
Description: For quantitative detection of human BCAM in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human S100A8 PicoKine ELISA Kit

EK1558 96 wells
EUR 425
Description: For quantitative detection of human S100A8 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human S100A13 PicoKine ELISA Kit

EK1568 96 wells
EUR 425
Description: For quantitative detection of human S100A13 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Siglec5 PicoKine ELISA Kit

EK1583 96 wells
EUR 425
Description: For quantitative detection of human Siglec5 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human HGFA PicoKine ELISA Kit

EK1592 96 wells
EUR 425
Description: For quantitative detection of human HGFA in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human ULBP2 PicoKine ELISA Kit

EK1593 96 wells
EUR 425
Description: For quantitative detection of human ULBP2 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Bikunin PicoKine ELISA Kit

EK1598 96 wells
EUR 425
Description: For Quantitative Detection of human Bikunin in cell culture supernates, serum and plasma (heparin, EDTA).

Human Dystroglycan PicoKine ELISA Kit

EK1614 96 wells
EUR 425
Description: For Quantitative Detection of human Dystroglycan in cell culture supernates, serum, plasma (heparin, EDTA), saliva and urine.

Human NOTCH1 PicoKine ELISA Kit

EK1619 96 wells
EUR 455
Description: For Quantitative Detection of human NOTCH1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human GSTA PicoKine ELISA Kit

EK1625 96 wells
EUR 425
Description: For quantitative detection of human GSTA in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CD209 PicoKine ELISA Kit

EK1632 96 wells
EUR 425
Description: For Quantitative Detection of human CD209 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Properdin PicoKine ELISA Kit

EK1653 96 wells
EUR 425
Description: For Quantitative Detection of human Properdin in cell culture supernates, serum and plasma (heparin, EDTA).

Human Autotaxin PicoKine ELISA Kit

EK1655 96 wells
EUR 425
Description: For Quantitative Detection of human Autotaxin in cell culture supernates, serum, plasma (heparin), urine and human milk.

Human CDNF PicoKine ELISA Kit

EK1656 96 wells
EUR 455
Description: For Quantitative Detection of human CDNF in cell culture supernates, serum and plasma (heparin, EDTA).

Human IL15RA PicoKine ELISA Kit

EK1663 96 wells
EUR 425
Description: For Quantitative Detection of human IL15RA in cell culture supernates, serum and plasma (heparin, EDTA).

Human SMOC2 PicoKine ELISA Kit

EK1664 96 wells
EUR 425
Description: For Quantitative Detection of human SMOC2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CDCP1 PicoKine ELISA Kit

EK1668 96 wells
EUR 455
Description: For Quantitative Detection of human CDCP1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human ITIH4 PicoKine ELISA Kit

EK1670 96 wells
EUR 455
Description: For quantitative detection of human ITIH4 in cell culture supernates, serum and plasma (heparin, EDTA).

Human TRKC PicoKine ELISA Kit

EK1676 96 wells
EUR 425
Description: For quantitative detection of human TRKC in cell culture supernates, serum and plasma (heparin, EDTA).

Human TREM2 PicoKine ELISA Kit

EK1678 96 wells
EUR 425
Description: For quantitative detection of human TREM2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human DAND5/COCO PicoKine ELISA Kit